MAP1B p.Glu683del
c.2045AAG[1] · rs768482904 · VCV2655512
Likely benign
Single submitter
Classification
Likely benign
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
gnomAD v4.1
Rare
ultra-rare (popmax 0.0171%, mid)
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
|---|---|---|
| Constraint at this position | ||
| Conservation | phyloP 8.7 | GERP 1.2, phastCons 1 |
| Overall | ||
| CADD | 18.33 | PHRED · no single calibrated threshold — expert panels disagree |
| Region caveats | ||
| Repeat context | tandem | GAAAAAAGAACCCAAAAAAGAGATCAAGAAAGAAGA simple repeat · ambiguous alignment · confidence, not pathogenicity |
Population frequency
gnomAD v4.1 · exomes + genomes
Grpmax group
0.0171%
Middle Eastern · 1/5,858 alleles
Filtering AF
0.00798%
ClinGen BA1/BS1 input
FAF95, joint · FAF99 0.00742%
Overall
0.00859%
134/1,560,172 alleles · ultra-rare
exomes 123/1,408,044 · genomes 11/152,128 · joint denominator
| Ancestry group | Frequency | 1 in |
|---|---|---|
| Middle Easterngrpmax | 0.0171% | 5,858 |
| Finnishnot grpmax-eligible | 0.0145% | 6,873 |
| Remaining individualsnot grpmax-eligible | 0.0116% | 8,649 |
| East Asian | 0.00949% | 10,541 |
| European (non-Finnish) | 0.00942% | 10,613 |
| Ashkenazi Jewishnot grpmax-eligible | 0.00702% | 14,255 |
| Admixed American | 0.00205% | 48,828 |
| African / African-American | 0.00138% | 72,212 |
Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.
Variant & gene context
- Gene
- MAP1B
- Protein
- p.Glu683del
- Coding
- c.2045AAG[1]
- MANE Select
- NM_005909
- dbSNP
- rs768482904
- Type
- Microsatellite
- Location
- chr5:72195400 (GRCh38)
- Gene constraint
- LOEUF 0.105 · pLI 1.00 (gnomAD)
- Structure
- AlphaFold pLDDT 46.18
- Residue 683
- the 'disordered' region; a UniProt-annotated variant site (in pvnh9)
Similar variants
- MAP1B p.Val2150fs Pathogenic ★ same type
- MAP1B p.Glu1388fs Uncertain significance ★ same type
- MAP1B p.Glu1885del Uncertain significance ★ same type
- MAP1B p.Ser87fs Likely pathogenic same type
- MAP1B p.Glu1023del Likely benign same type
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/map1b-p-glu683del (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown