Is PCNT p.Ala2149fs (c.6445dup) pathogenic?

PCNT p.Ala2149fs (c.6445dup) is classified Pathogenic in PCNT (ClinVar, Single submitter, 1 submitter; last evaluated 2023-10-06). Very rare (popmax 8.47e-05%, nfe).

How common is PCNT p.Ala2149fs (c.6445dup) in the general population?

PCNT p.Ala2149fs (c.6445dup) is very rare (popmax 8.47e-05%, nfe) (gnomAD).

PCNT p.Ala2149fs

c.6445dup · rs2518829375 · VCV3003599

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 8.47e-05%, nfe)

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 30 of 47
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -0.2	GERP -0.74, phastCons 0.008
Region caveats
Repeat context	tandem	CATAGACACATGTGATGCCAATACAACCACAGGGGGTGTAACTGATGTTATCAAAAATCAGGC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 8.47e-05% European (non-Finnish) · 1/1,179,986 alleles

Overall 6.2e-05% 1/1,614,078 alleles · very rare exomes 1/1,461,822 · genomes 0/152,256 · joint denominator

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: PCNT
Protein: p.Ala2149fs
Coding: c.6445dup
MANE Select: NM_006031
dbSNP: rs2518829375
Type: Duplication
Location: chr21:46416362 (GRCh38)
Gene constraint: LOEUF 0.943 · pLI <0.01 (gnomAD)

Full PCNT gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

PCNT p.Ala2149Ser Uncertain significance ★ ⚠ same residue
PCNT p.Ala2149Thr Uncertain significance ★ ⚠ same residue
PCNT p.Ala2149= Likely benign ★ same residue
PCNT p.Ala2149Val Uncertain significance ⚠ same residue
PCNT p.Ala2957fs Pathogenic ★★ same type
PCNT p.Gln783fs Pathogenic ★★ same type
PCNT p.Glu998fs Pathogenic/Likely pathogenic ★★ same type
PCNT p.His2484fs Pathogenic/Likely pathogenic ★★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/pcnt-p-ala2149fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown