PCNT p.Asp2148fs
c.6443_6444delinsCTA · VCV3346735
Likely pathogenic
No assertion criteria
Classification
Likely pathogenic
ClinVar
Review
No assertion criteria ☆☆☆☆
ClinVar · 1 submitter
Consequence
frameshift
predicted LoF
gnomAD v4.1
Rare
Conditions
1
PCNT-related disorder
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function |
|---|---|---|
| NMD | predicted | premature termination codon in exon 30 of 47 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP 0.73 | GERP -0.72, phastCons 0.016 |
| Region caveats | ||
| Repeat context | tandem | CATAGACACATGTGATGCCAATACAACCACAGGGGGTGTAACTGATGTTATCAAAAATCAGGC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Variant & gene context
- Gene
- PCNT
- Protein
- p.Asp2148fs
- Coding
- c.6443_6444delinsCTA
- MANE Select
- NM_006031
- Type
- Indel
- Location
- chr21:46416361 (GRCh38)
- Gene constraint
- LOEUF 0.943 · pLI <0.01 (gnomAD)
Disease context
PCNT-related disorder
Similar variants
- PCNT p.Asp2148= Likely benign ★ same residue
- PCNT p.Gln1128_Arg1129delinsHisTrp Uncertain significance same condition
- PCNT c.3313-2A>C Likely pathogenic ★★ same condition
- PCNT c.7024+1G>A Likely pathogenic ★★ same condition
- PCNT c.7691-1G>A Likely pathogenic ★★ same condition
- PCNT c.8065-1G>C Likely pathogenic ★★ same condition
- PCNT p.Arg2865fs Pathogenic ★★ same condition
- PCNT p.Arg3236Ter Pathogenic/Likely pathogenic ★★ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/pcnt-p-asp2148fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown