Is PCNT p.Val2138fs (c.6412dup) pathogenic?

PCNT p.Val2138fs (c.6412dup) is classified Pathogenic/Likely pathogenic in PCNT (ClinVar, Multiple submitters, 3 submitters; last evaluated 2024-05-30). Very rare (popmax 0.00334%, amr); Associated with microcephalic osteodysplastic primordial dwarfism type II.

What condition is associated with PCNT p.Val2138fs (c.6412dup)?

PCNT p.Val2138fs (c.6412dup) is associated with microcephalic osteodysplastic primordial dwarfism type II (ClinVar).

How common is PCNT p.Val2138fs (c.6412dup) in the general population?

PCNT p.Val2138fs (c.6412dup) is very rare (popmax 0.00334%, amr) (gnomAD).

PCNT p.Val2138fs

c.6412dup · rs746584417 · VCV1069878

Pathogenic/Likely pathogenic Multiple submitters

Classification

Pathogenic/Likely pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 3 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.00334%, amr)

Conditions

microcephalic osteodysplastic primordial dwarfism type II

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 30 of 47
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.13	GERP -0.2, phastCons 0.055
Region caveats
Repeat context	tandem	CATAGACACATGTGATGCCAATACAACCACAGGGGGTGTAACTGATGTTATCAAAAATCAGGC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00334% Admixed American · 2/59,952 alleles

Filtering AF 0.000553% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000207%

Overall 0.000124% 2/1,613,214 alleles · very rare exomes 2/1,461,526 · genomes 0/151,688 · joint denominator

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: PCNT
Protein: p.Val2138fs
Coding: c.6412dup
MANE Select: NM_006031
dbSNP: rs746584417
Type: Duplication
Location: chr21:46416329 (GRCh38)
Gene constraint: LOEUF 0.943 · pLI <0.01 (gnomAD)

Full PCNT gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

microcephalic osteodysplastic primordial dwarfism type II — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

PCNT p.Ala2957fs Pathogenic ★★ same condition
PCNT p.Glu998fs Pathogenic/Likely pathogenic ★★ same condition
PCNT p.His2484fs Pathogenic/Likely pathogenic ★★ same condition
PCNT p.Leu1200fs Pathogenic/Likely pathogenic ★★ same condition
PCNT p.Val3179fs Pathogenic/Likely pathogenic ★★ same condition
PCNT p.Arg143_Gln155dup Uncertain significance ★★ same condition
PCNT p.Val2138Ile Uncertain significance ★★ ⚠ same residue
PCNT c.8751+23dup Benign ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/pcnt-p-val2138fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown