Is POLE p.Ala448fs (c.1342dup) pathogenic?

POLE p.Ala448fs (c.1342dup) is classified Pathogenic in POLE (ClinVar, Single submitter, 1 submitter; last evaluated 2022-11-14). Absent from gnomAD.

How common is POLE p.Ala448fs (c.1342dup) in the general population?

POLE p.Ala448fs (c.1342dup) is absent from gnomAD (gnomAD).

POLE p.Ala448fs

c.1342dup · rs2542145071 · VCV2814194

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 13 of 49
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 12	GERP 1.7, phastCons 1
Region caveats
Repeat context	tandem	ATGCGTGCACACGGCAGCAGGGGCAGCCGGGATGTGGCTCACATGCCTGGGGCTGCTCCGTGGCCATCTGG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: POLE
Protein: p.Ala448fs
Coding: c.1342dup
MANE Select: NM_006231
dbSNP: rs2542145071
Type: Duplication
Location: chr12:132673591 (GRCh38)
Gene constraint: LOEUF 0.75 · pLI <0.01 · ClinGen HI 1/3 (gnomAD)
Structure: AlphaFold pLDDT 80.32 · 18 PDB

Full POLE gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

POLE p.Ala448= Benign/Likely benign ★★ same residue
POLE c.802-2dup Uncertain significance ★★ same type
POLE c.802-7_818dup Uncertain significance ★★ same type
POLE p.Asp1026_Leu1032dup Uncertain significance ★★ same type
POLE p.Gln1950_Glu1956dup Uncertain significance ★★ same type
POLE p.Glu1963_Asn1971dup Uncertain significance ★★ same type
POLE p.Ile1864dup Uncertain significance ★★ same type
POLE p.Leu1975_Leu1976insAspLeu Uncertain significance ★★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/pole-p-ala448fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown