Is PRG4 p.Pro693fs (c.2078del) pathogenic?

PRG4 p.Pro693fs (c.2078del) is classified Pathogenic in PRG4 (ClinVar, Single submitter, 1 submitter; last evaluated 2025-10-03). Very rare (popmax 0.000848%, nfe); Associated with camptodactyly-arthropathy-coxa vara-pericarditis syndrome.

What condition is associated with PRG4 p.Pro693fs (c.2078del)?

PRG4 p.Pro693fs (c.2078del) is associated with camptodactyly-arthropathy-coxa vara-pericarditis syndrome (ClinVar).

How common is PRG4 p.Pro693fs (c.2078del) in the general population?

PRG4 p.Pro693fs (c.2078del) is very rare (popmax 0.000848%, nfe) (gnomAD).

PRG4 p.Pro693fs

Q: How is Camptodactyly-arthropathy-coxa-vara-pericarditis syndrome inherited?

Typically Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

c.2078del · rs764302838 · VCV4854505

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.000848%, nfe)

Conditions

camptodactyly-arthropathy-coxa vara-pericarditis syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 7 of 13
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -7.3	GERP 0.59
Overall
CADD	14.27	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	CACCACTCCCAAGGAGCCTGCACC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.000848% European (non-Finnish) · 10/1,179,408 alleles

Filtering AF 0.000429% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000313%

Overall 0.000683% 11/1,610,656 alleles · very rare exomes 9/1,460,914 · genomes 2/149,742 · joint denominator

Ancestry group	Frequency	1 in
Finnishnot grpmax-eligible	0.00157%	63,518
European (non-Finnish)grpmax	0.000848%	117,941

Finnish shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: PRG4
Protein: p.Pro693fs
Coding: c.2078del
MANE Select: NM_005807
dbSNP: rs764302838
Type: Deletion
Location: chr1:186307794 (GRCh38)
Gene constraint: LOEUF 0.801 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 48.76
Residue 693: the 'disordered' region; the '59 x 8 aa repeats of k-x-p-x-p-t-t-x' region

Full PRG4 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

camptodactyly-arthropathy-coxa vara-pericarditis syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Camptodactyly-arthropathy-coxa-vara-pericarditis syndrome (Orphanet):

Inheritance: Autosomal recessive
Onset: Childhood, Infancy, Neonatal

Similar variants

PRG4 p.Arg1302fs Pathogenic/Likely pathogenic ★★ same condition
PRG4 p.Glu646fs Pathogenic ★★ same condition
PRG4 p.Lys939fs Pathogenic ★★ same condition
PRG4 p.Pro637fs Pathogenic ★★ same condition
PRG4 p.Glu1003fs Pathogenic ★ same condition
PRG4 p.Glu567fs Pathogenic ★ same condition
PRG4 p.Leu924fs Likely pathogenic ★ same condition
PRG4 p.Thr399fs Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/prg4-p-pro693fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown