Is PRX p.Pro575Thr (c.1722_1723delinsCA) pathogenic?

PRX p.Pro575Thr (c.17221723delinsCA) is classified Uncertain significance in PRX (ClinVar, Single submitter, 1 submitter; last evaluated 2024-02-19). No gnomAD frequency available for this variant; Associated with Charcot-Marie-Tooth disease type 4.

What condition is associated with PRX p.Pro575Thr (c.1722_1723delinsCA)?

PRX p.Pro575Thr (c.1722_1723delinsCA) is associated with Charcot-Marie-Tooth disease type 4 (ClinVar).

How common is PRX p.Pro575Thr (c.1722_1723delinsCA) in the general population?

PRX p.Pro575Thr (c.1722_1723delinsCA) is no gnomAD frequency available for this variant (gnomAD).

PRX p.Pro575Thr

c.1722_1723delinsCA · rs2079440418 · VCV1015349

Uncertain significance Single submitter

Classification

Uncertain significance

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

Charcot-Marie-Tooth disease type 4

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 6.7	GERP 1.5, phastCons 1
Regional constraint	o/e 0.96	unconstrained · MANE · 2,740 bp · p 0.15 · regional, not allelic
Region caveats
Repeat context	tandem	GGGAGTTTCATCTCTGACACTTTCGGCAGCTGTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTT simple repeat · ambiguous alignment · confidence, not pathogenicity

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: PRX
Protein: p.Pro575Thr
Coding: c.1722_1723delinsCA
MANE Select: NM_181882
dbSNP: rs2079440418
Type: Indel
Location: chr19:40396629 (GRCh38)
Gene constraint: LOEUF 1.321 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 35.74 · 1 PDB
Residue 575: the '55 x 5 aa approximate tandem repeats of [lvmag]-[psreqc]-[edkl]-[livmap]-[aqkhrpe]; that may have a tripeptide spacer of [lv]-p-[ker]' region

Full PRX gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

Charcot-Marie-Tooth disease type 4 — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

PRX p.Pro575= Likely benign ★★ same residue
PRX p.Pro575Leu Uncertain significance ★ ⚠ same residue
PRX p.Pro1083Trp Uncertain significance ★ same condition
PRX p.Val1118Ile Uncertain significance ★ same condition
PRX p.Val657Lys Uncertain significance ★ same condition
PRX c.184+2T>C Likely pathogenic ★★ same condition
PRX p.Ala210fs Pathogenic ★★ same condition
PRX p.Arg1070Ter Pathogenic/Likely pathogenic ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/prx-p-pro575thr (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown