Is SON p.Ala787Ter (c.2357_2358dup) pathogenic?

SON p.Ala787Ter (c.23572358dup) is classified Pathogenic in SON (ClinVar, Single submitter, 1 submitter; last evaluated 2022-02-02). No gnomAD frequency available for this variant; Associated with ZTTK syndrome.

What condition is associated with SON p.Ala787Ter (c.2357_2358dup)?

SON p.Ala787Ter (c.2357_2358dup) is associated with ZTTK syndrome (ClinVar).

How common is SON p.Ala787Ter (c.2357_2358dup) in the general population?

SON p.Ala787Ter (c.2357_2358dup) is no gnomAD frequency available for this variant (gnomAD).

SON p.Ala787Ter

c.2357_2358dup · rs2145823461 · VCV1699464

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

nonsense (stop-gain)

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

ZTTK syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	nonsense (stop-gain)	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 3 of 12
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 1.1	GERP 2.6, phastCons 1
Region caveats
Repeat context	tandem	TCCCAGATGTTAGCATCCAACACCATGGAC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: SON
Protein: p.Ala787Ter
Coding: c.2357_2358dup
MANE Select: NM_138927
dbSNP: rs2145823461
Type: Duplication
Location: chr21:33551587 (GRCh38)
Gene constraint: LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 36.48 · 4 PDB
Residue 787: the '17 x 10 aa tandem repeats of l-a-[st]-[nsg]-[ts]-mdsqm' region

Full SON gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

ZTTK syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

SON p.Arg1908fs Pathogenic ★★ same condition
SON p.Met1025fs Likely pathogenic ★★ same condition
SON p.Ala2413fs Benign ★★ same condition
SON p.Tyr1230_Thr1247dup Likely benign ★★ same condition
SON p.Ala1542fs Likely pathogenic ★ same condition
SON p.Asp1134fs Pathogenic ★ same condition
SON p.Asp1788fs Pathogenic ★ same condition
SON p.Leu1632fs Likely pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-ala787ter (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown