Is SON p.Arg950fs (c.2847_2848dup) pathogenic?

SON p.Arg950fs (c.28472848dup) is classified Likely pathogenic in SON (ClinVar, Single submitter, 1 submitter; last evaluated 2023-08-16). No gnomAD frequency available for this variant; Associated with SON-related disorder.

What condition is associated with SON p.Arg950fs (c.2847_2848dup)?

SON p.Arg950fs (c.2847_2848dup) is associated with SON-related disorder (ClinVar).

How common is SON p.Arg950fs (c.2847_2848dup) in the general population?

SON p.Arg950fs (c.2847_2848dup) is no gnomAD frequency available for this variant (gnomAD).

SON p.Arg950fs

c.2847_2848dup · rs2517366003 · VCV2631779

Likely pathogenic Single submitter

Classification

Likely pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

SON-related disorder

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 3 of 12
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -7.1	GERP -9.3
Region caveats
Repeat context	tandem	CCCTATAGATTAGCTCAGGATCCTTACAGGTTAGCACAAGATCCCTATAGATTAGGCCATGAC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: SON
Protein: p.Arg950fs
Coding: c.2847_2848dup
MANE Select: NM_138927
dbSNP: rs2517366003
Type: Microsatellite
Location: chr21:33552075 (GRCh38)
Gene constraint: LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 36.48 · 4 PDB
Residue 950: the '11 x 7 aa tandem repeats of [dr]-p-y-r-[li][ag][qhp]' region; a modified residue (omega-n-methylarginine)

Full SON gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

SON-related disorder

Similar variants

SON p.Arg1047fs Likely pathogenic ★ same condition
SON p.Glu1687_Ser1688insTer Likely pathogenic ★ same condition
SON p.Tyr129fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Gln45Pro Uncertain significance ★★ ⚠ same condition
SON p.Leu1666Val Uncertain significance ★★ ⚠ same condition
SON p.Pro431His Uncertain significance ★★ ⚠ same condition
SON p.Ser609Leu Uncertain significance ★★ ⚠ same condition
SON p.Thr1382Ser Uncertain significance ★★ ⚠ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-arg950fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown