SON p.Asp772fs
c.2313_2314dup · VCV4946132
Likely pathogenic
Single submitter
Classification
Likely pathogenic
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
Consequence
frameshift
predicted LoF
gnomAD v4.1
Rare
Conditions
1
SON-related disorder
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function in a haploinsufficient gene (ClinGen) |
|---|---|---|
| NMD | predicted | premature termination codon in exon 3 of 12 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP 5.4 | GERP 4.6, phastCons 1 |
| Region caveats | ||
| Repeat context | tandem | TCCCAGATGTTAGCATCCAACACCATGGAC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Variant & gene context
- Gene
- SON
- Protein
- p.Asp772fs
- Coding
- c.2313_2314dup
- MANE Select
- NM_138927
- Type
- Duplication
- Location
- chr21:33551543 (GRCh38)
- Gene constraint
- LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
- Structure
- AlphaFold pLDDT 36.48 · 4 PDB
- Residue 772
- the '17 x 10 aa tandem repeats of l-a-[st]-[nsg]-[ts]-mdsqm' region
Disease context
SON-related disorder
Similar variants
- SON p.Tyr129fs Pathogenic/Likely pathogenic ★★ same condition
- SON c.6469-3dup Likely benign same condition
- SON p.Gln45Pro Uncertain significance ★★ ⚠ same condition
- SON p.Leu1666Val Uncertain significance ★★ ⚠ same condition
- SON p.Pro431His Uncertain significance ★★ ⚠ same condition
- SON p.Ser609Leu Uncertain significance ★★ ⚠ same condition
- SON p.Thr1382Ser Uncertain significance ★★ ⚠ same condition
- SON p.Ala1600fs Pathogenic ★ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-asp772fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown