Is SON p.Ser1116fs (c.3347_3366del) pathogenic?

SON p.Ser1116fs (c.33473366del) is classified Pathogenic in SON (ClinVar, Single submitter, 1 submitter; last evaluated 2024-07-25). Associated with ZTTK syndrome.

What condition is associated with SON p.Ser1116fs (c.3347_3366del)?

SON p.Ser1116fs (c.3347_3366del) is associated with ZTTK syndrome (ClinVar).

SON p.Ser1116fs

c.3347_3366del · VCV3765867

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

Conditions

ZTTK syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 3 of 12
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 7.9	GERP 4.5, phastCons 1
Region caveats
Repeat context	tandem	TGCTGACCGGTCTATGATGTCATCATACTCTGC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Variant & gene context

Gene: SON
Protein: p.Ser1116fs
Coding: c.3347_3366del
MANE Select: NM_138927
Type: Deletion
Location: chr21:33552576 (GRCh38)
Gene constraint: LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 36.48 · 4 PDB
Residue 1116: the '14 x 6 aa repeats of [ed]-r-s-m-m-s' region

Full SON gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

ZTTK syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

SON p.Arg1906fs Pathogenic ★★ same condition
SON p.Lys128fs Pathogenic ★★ same condition
SON p.Lys1888fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Met1284fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Thr1633fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Val1918fs Pathogenic/Likely pathogenic ★★ same condition
SON p.729NTMDSQMLAS[2] Uncertain significance ★★ same condition
SON c.6321+1del Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-ser1116fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown