Is SON p.Ser1379fs (c.4132_4153del) pathogenic?

SON p.Ser1379fs (c.41324153del) is classified Likely benign in SON (ClinVar, Single submitter, 1 submitter; last evaluated 2019-08-28). Very rare (popmax 0.00017%, nfe); Associated with ZTTK syndrome.

What condition is associated with SON p.Ser1379fs (c.4132_4153del)?

SON p.Ser1379fs (c.4132_4153del) is associated with ZTTK syndrome (ClinVar).

How common is SON p.Ser1379fs (c.4132_4153del) in the general population?

SON p.Ser1379fs (c.4132_4153del) is very rare (popmax 0.00017%, nfe) (gnomAD).

SON p.Ser1379fs

c.4132_4153del · rs2517378506 · VCV1806375

Likely benign Single submitter

Classification

Likely benign

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.00017%, nfe)

Conditions

ZTTK syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 3 of 12
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 2.1	GERP 2.2, phastCons 0.48
Region caveats
Repeat context	tandem	GAGTCTTCGGCTGTGACTGTCCTG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00017% European (non-Finnish) · 2/1,178,030 alleles

Filtering AF 2.8e-05% ClinGen BA1/BS1 input FAF95, joint · FAF99 1.1e-05%

Overall 0.000124% 2/1,611,922 alleles · very rare exomes 2/1,459,848 · genomes 0/152,074 · joint denominator

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: SON
Protein: p.Ser1379fs
Coding: c.4132_4153del
MANE Select: NM_138927
dbSNP: rs2517378506
Type: Deletion
Location: chr21:33553362 (GRCh38)
Gene constraint: LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 36.48 · 4 PDB
Residue 1379: the '4 x 8 aa tandem repeats of v-l-e-ss-[avt]-vt' region

Full SON gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

ZTTK syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

SON p.Arg1906fs Pathogenic ★★ same condition
SON p.Lys128fs Pathogenic ★★ same condition
SON p.Lys1888fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Met1284fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Thr1633fs Pathogenic/Likely pathogenic ★★ same condition
SON p.Val1918fs Pathogenic/Likely pathogenic ★★ same condition
SON p.729NTMDSQMLAS[2] Uncertain significance ★★ same condition
SON c.6321+1del Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-ser1379fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown