SON p.Ser1964Ile
c.5891_5892delinsTT · rs2085934599 · VCV1030017
Uncertain significance
Single submitter
Classification
Uncertain significance
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
gnomAD v4.1
Not reported
no gnomAD frequency available for this variant
Conditions
1
ZTTK syndrome
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
|---|---|---|
| Constraint at this position | ||
| Conservation | phyloP 10 | GERP 3.3, phastCons 1 |
| Regional constraint | o/e 0.62 | unconstrained · MANE · 2,181 bp · p 1.3e-08 · regional, not allelic |
| Region caveats | ||
| Repeat context | tandem | CCCCCAGCCGCCGCAGCCGCA simple repeat · ambiguous alignment · confidence, not pathogenicity |
Population frequency
dbSNP / gnomAD
No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.
Variant & gene context
- Gene
- SON
- Protein
- p.Ser1964Ile
- Coding
- c.5891_5892delinsTT
- MANE Select
- NM_138927
- dbSNP
- rs2085934599
- Type
- Indel
- Location
- chr21:33555122 (GRCh38)
- Gene constraint
- LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
- Structure
- AlphaFold pLDDT 36.48 · 4 PDB
- Residue 1964
- the 'disordered' region; the '7 x 7 aa repeats of p-s-r-r-s-r-[ts]' region; the '2 x 19 aa repeats of p-s-r-r-r-r-s-r-s-v-v-r-r-r-s-f-s-i-s' region
Similar variants
- SON p.Ala1768_Val1772del Uncertain significance ★★ same condition
- SON p.Leu1507_Glu1512delinsAlaCysSerIle Uncertain significance ★★ same condition
- SON c.245-485_273delinsGTTG Likely pathogenic ★ same condition
- SON p.Glu315fs Likely pathogenic ★ same condition
- SON p.Leu993fs Likely pathogenic ★ same condition
- SON p.Ser1323fs Pathogenic ★ same condition
- SON p.Ser1845fs Pathogenic ★ same condition
- SON c.6321+1G>A Pathogenic ★★ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-ser1964ile (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown