SON p.Ser1989fs
c.5964del · rs1601275471 · VCV651689
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type. | ||
| Consequence | frameshift | predicted loss-of-function in a haploinsufficient gene (ClinGen) |
|---|---|---|
| NMD | predicted | premature termination codon in exon 3 of 12 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Region caveats | ||
| Repeat context | tandem | CCCCCAGCCGCCGCAGCCGCA simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Population frequency
No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.
Variant & gene context
- Gene
- SON
- Protein
- p.Ser1989fs
- Coding
- c.5964del
- MANE Select
- NM_138927
- dbSNP
- rs1601275471
- Type
- Deletion
- Location
- chr21:33555195 (GRCh38)
- Gene constraint
- LOEUF 0.051 · pLI 1.00 · ClinGen HI 3/3 (gnomAD)
- Structure
- AlphaFold pLDDT 36.48 · 4 PDB
- Residue 1989
- the 'disordered' region; the '7 x 7 aa repeats of p-s-r-r-s-r-[ts]' region; the '2 x 19 aa repeats of p-s-r-r-r-r-s-r-s-v-v-r-r-r-s-f-s-i-s' region
Similar variants
- SON p.Ser1989Asn Uncertain significance ★★ ⚠ same residue
- SON p.Ser1989Thr Uncertain significance ★ ⚠ same residue
- SON p.Ser1989Gly Likely benign ★ ⚠ same residue
- SON p.Arg1906fs Pathogenic ★★ same type
- SON p.Lys128fs Pathogenic ★★ same type
- SON p.Lys1888fs Pathogenic/Likely pathogenic ★★ same type
- SON p.Met1284fs Pathogenic/Likely pathogenic ★★ same type
- SON p.Thr1633fs Pathogenic/Likely pathogenic ★★ same type
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/son-p-ser1989fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown