Is STAT3 p.Val463del (c.1384GTG[1]) pathogenic?

STAT3 p.Val463del (c.1384GTG[1]) is classified Pathogenic in STAT3 (ClinVar, Multiple submitters, 5 submitters; last evaluated 2022-08-09). Absent from gnomAD; Associated with STAT3 gain of function.

What condition is associated with STAT3 p.Val463del (c.1384GTG[1])?

STAT3 p.Val463del (c.1384GTG[1]) is associated with STAT3 gain of function, hyper-IgE recurrent infection syndrome 1, autosomal dominant (ClinVar).

How common is STAT3 p.Val463del (c.1384GTG[1]) in the general population?

STAT3 p.Val463del (c.1384GTG[1]) is absent from gnomAD (gnomAD).

STAT3 p.Val463del

c.1384GTG[1] · rs113994138 · VCV18303

Pathogenic Multiple submitters

Classification

Pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 5 submitters

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

STAT3 gain of function

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 7.9	GERP 1.9, phastCons 1

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: STAT3
Protein: p.Val463del
Coding: c.1384GTG[1]
MANE Select: NM_139276
dbSNP: rs113994138
Type: Microsatellite
Location: chr17:42325038 (GRCh38)
Gene constraint: LOEUF 0.109 · pLI 1.00 (gnomAD)
Structure: AlphaFold pLDDT 85.80 · 6 PDB
Residue 463: a β-strand; a UniProt-annotated variant site (in hies1; loss of function)

Full STAT3 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

STAT3 gain of function — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Also linked: hyper-IgE recurrent infection syndrome 1, autosomal dominant

Similar variants

STAT3 c.1110-19_1110-17del Benign/Likely benign ★★ same condition
STAT3 c.551-57_551-18del Likely benign ★★ same condition
STAT3 c.551-77ATTCCCTCAGGTCAAGGAGT[2] Benign/Likely benign ★★ same condition
STAT3 c.1111_1112del Uncertain significance ★ same condition
STAT3 c.1601-72_1601-71del Conflicting classifications of pathogenicity ★ same condition
STAT3 p.Arg595_Ala596insGluArg Uncertain significance ★ same condition
STAT3 p.Gln644del Uncertain significance ★ same condition
STAT3 p.Glu616del Uncertain significance ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/stat3-p-val463del (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown