Is VHL p.Phe91fs (c.273del) pathogenic?

VHL p.Phe91fs (c.273del) is classified Likely pathogenic in VHL (ClinVar, Single submitter, 1 submitter; last evaluated 2015-09-22). No gnomAD frequency available for this variant.

How common is VHL p.Phe91fs (c.273del) in the general population?

VHL p.Phe91fs (c.273del) is no gnomAD frequency available for this variant (gnomAD).

VHL p.Phe91fs

c.273del · rs1559426047 · VCV560740

Likely pathogenic Single submitter

Classification

Likely pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 1 of 3
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 5.6	GERP 1.5, phastCons 1

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: VHL
Protein: p.Phe91fs
Coding: c.273del
MANE Select: NM_000551
dbSNP: rs1559426047
Type: Deletion
Location: chr3:10142120 (GRCh38)
Gene constraint: LOEUF 0.987 · pLI <0.01 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 85.45 · 143 PDB
Residue 91: a β-strand; a UniProt-annotated variant site (in cerebellar hemangioblastoma; uncertain significance)

Full VHL gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

VHL p.Phe91Leu Uncertain significance ★★★ ⚠ same residue
VHL p.Phe91= Benign/Likely benign ★★ same residue
VHL p.Phe91Val Likely benign ★ same residue
VHL c.335_340+5del Likely pathogenic ★★ same type
VHL c.-75_-55delCGCACGCAGCTCCGCCCCGCG Likely pathogenic ★★ same type
VHL p.Gly93fs Pathogenic ★★ same type
VHL p.Val62fs Pathogenic ★★ same type
VHL c.-39_-10del Uncertain significance ★★ same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/vhl-p-phe91fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown