Is VHL p.Pro61fs (c.180_193del) pathogenic?

VHL p.Pro61fs (c.180193del) is classified Pathogenic in VHL (ClinVar, Single submitter, 1 submitter; last evaluated 2021-12-18). No gnomAD frequency available for this variant; Associated with hereditary neoplastic syndrome.

What condition is associated with VHL p.Pro61fs (c.180_193del)?

VHL p.Pro61fs (c.180_193del) is associated with hereditary neoplastic syndrome (ClinVar).

How common is VHL p.Pro61fs (c.180_193del) in the general population?

VHL p.Pro61fs (c.180_193del) is no gnomAD frequency available for this variant (gnomAD).

VHL p.Pro61fs

c.180_193del · rs2470157947 · VCV1780385

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

hereditary neoplastic syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 1 of 3
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 2	GERP -3.4, phastCons 1

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: VHL
Protein: p.Pro61fs
Coding: c.180_193del
MANE Select: NM_000551
dbSNP: rs2470157947
Type: Deletion
Location: chr3:10142027 (GRCh38)
Gene constraint: LOEUF 0.987 · pLI <0.01 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 85.45 · 143 PDB
Residue 61: an α-helix; the 'disordered' region

Full VHL gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

hereditary neoplastic syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Similar variants

VHL p.Pro61= Benign ★★★ same residue
VHL p.Pro61Leu Uncertain significance ★★ ⚠ same residue
VHL p.Pro61Ser Uncertain significance ★★ same residue
VHL p.Pro61Ala Conflicting classifications of pathogenicity ★ ⚠ same residue
VHL c.335_340+5del Likely pathogenic ★★ same condition
VHL c.-75_-55delCGCACGCAGCTCCGCCCCGCG Likely pathogenic ★★ same condition
VHL p.Gly93fs Pathogenic ★★ same condition
VHL p.Val62fs Pathogenic ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/vhl-p-pro61fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown