Is CAVIN4 p.Ser251fs (c.751_754del) pathogenic?

CAVIN4 p.Ser251fs (c.751754del) is classified Uncertain significance in CAVIN4 (ClinVar, Single submitter, 1 submitter; last evaluated 2019-01-23). Very rare (popmax 0.000255%, nfe).

How common is CAVIN4 p.Ser251fs (c.751_754del) in the general population?

CAVIN4 p.Ser251fs (c.751_754del) is very rare (popmax 0.000255%, nfe) (gnomAD).

CAVIN4 p.Ser251fs

c.751_754del · rs2118615248 · VCV1305225

Uncertain significance Single submitter

Classification

Uncertain significance

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.000255%, nfe)

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (2 of 2) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -0.79	GERP -3.4
Region caveats
Repeat context	tandem	GAGAGAGGCTGAGACAGTCAG simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.000255% European (non-Finnish) · 3/1,177,214 alleles

Filtering AF 6.8e-05% ClinGen BA1/BS1 input FAF95, joint · FAF99 1.9e-05%

Overall 0.000186% 3/1,609,284 alleles · very rare exomes 3/1,457,072 · genomes 0/152,212 · joint denominator

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: CAVIN4
Protein: p.Ser251fs
Coding: c.751_754del
MANE Select: NM_001018116
dbSNP: rs2118615248
Type: Deletion
Location: chr9:100586104 (GRCh38)
Gene constraint: LOEUF 0.875 · pLI 0.02 (gnomAD)
Structure: AlphaFold pLDDT 66.21
Residue 251: the 'disordered' region

Full CAVIN4 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Similar variants

CAVIN4 p.234LRQSGER[2] Likely benign ★ same type
CAVIN4 p.Ala322fs Uncertain significance same type

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/cavin4-p-ser251fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown