CD151 c.615+44del
Benign
Single submitter
Classification
Benign
ClinVar
Review
Single submitter ★☆☆☆
ClinVar · 1 submitter
gnomAD v4.1
Common
common (popmax 56.5%, amr) — too common for a highly-penetrant pathogenic allele
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Splicing | ||
| Splice region | donor +44 | near-intronic (+44 nt from the splice site) |
|---|---|---|
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP -0.67 | GERP -1.8, phastCons 0.011 |
| Overall | ||
| CADD | 0.301 | PHRED · no single calibrated threshold — expert panels disagree |
| Region caveats | ||
| Repeat context | tandem | GCCTCCAATATCTACGAGGAGGTGGGGGGGCACCCCAGTGGCTGGCTGTGGGCAGTGAGACCAC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Population frequency
gnomAD v4.1 · exomes + genomes
Grpmax group
56.5%
Admixed American · 33,012/58,418 alleles
Filtering AF
56%
ClinGen BA1/BS1 input
FAF95, joint · FAF99 55.8%
Overall
49.6%
777,691/1,566,738 alleles · common
| Ancestry group | Frequency | 1 in |
|---|---|---|
| Admixed Americangrpmax | 56.5% | 2 |
| Finnishnot grpmax-eligible | 54.7% | 2 |
| Amishnot grpmax-eligible | 53.5% | 2 |
| European (non-Finnish) | 53.3% | 2 |
| Remaining individualsnot grpmax-eligible | 46.9% | 2 |
| Ashkenazi Jewishnot grpmax-eligible | 42.3% | 2 |
| Middle Eastern | 41.6% | 2 |
| African / African-American | 37.9% | 3 |
| East Asian | 27.1% | 4 |
| South Asian | 19.9% | 5 |
Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.
Variant & gene context
- Gene
- CD151
- Coding
- c.615+44del
- MANE Select
- NM_004357
- dbSNP
- rs56265615
- Type
- Deletion
- Location
- chr11:837662 (GRCh38)
- Gene constraint
- LOEUF 0.816 · pLI <0.01 (gnomAD)
- Structure
- AlphaFold pLDDT 88.02
Similar variants
- CD151 p.Cys208_Thr210del Likely pathogenic ★ same type
- CD151 c.616-42_616-11del Uncertain significance ★ same type
- CD151 p.Gly176fs Uncertain significance ★ same type
- CD151 p.Thr10del Uncertain significance ★ same type
- CD151 c.276+107del Benign ★ same type
- CD151 c.277-3del Benign ★ same type
- CD151 c.615+51del Benign ★ same type
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/cd151-c-615-plus-44del (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown