Is DNAAF1 p.Pro447fs (c.1340del) pathogenic?

DNAAF1 p.Pro447fs (c.1340del) is classified Pathogenic in DNAAF1 (ClinVar, Single submitter, 1 submitter; last evaluated 2026-04-24). Very rare (popmax 0.0027%, afr); Associated with primary ciliary dyskinesia.

What condition is associated with DNAAF1 p.Pro447fs (c.1340del)?

DNAAF1 p.Pro447fs (c.1340del) is associated with primary ciliary dyskinesia (ClinVar).

How common is DNAAF1 p.Pro447fs (c.1340del) in the general population?

DNAAF1 p.Pro447fs (c.1340del) is very rare (popmax 0.0027%, afr) (gnomAD).

How is Primary ciliary dyskinesia inherited?

Typically Autosomal dominant, Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

DNAAF1 p.Pro447fs

c.1340del · VCV4869897

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

very rare (popmax 0.0027%, afr)

Conditions

primary ciliary dyskinesia

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 8 of 12
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -2.5	GERP -0.37
Overall
CADD	14.63	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	CCTGTGGAGGTTAAAGGAGAGGATGGAGATCGAGAGCCAGAGGGGACCCTCCCAGCTGAGACCCTGCTACTGTCGCCA simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.0027% African / African-American · 2/74,144 alleles

Filtering AF 0.000448% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000168%

Overall 0.000125% 2/1,603,056 alleles · very rare exomes 0/1,452,204 · genomes 2/150,852 · joint denominator

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: DNAAF1
Protein: p.Pro447fs
Coding: c.1340del
MANE Select: NM_178452
Type: Deletion
Location: chr16:84170165 (GRCh38)
Gene constraint: LOEUF 1.135 · pLI <0.01 · ClinGen HI gene assoc. with recessive phenotype (gnomAD)
Structure: AlphaFold pLDDT 61.56
Residue 447: the 'disordered' region

Full DNAAF1 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

primary ciliary dyskinesia — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Primary ciliary dyskinesia (Orphanet):

Inheritance: Autosomal dominant, Autosomal recessive, X-linked recessive
Onset: Neonatal
Prevalence: 1-5 / 10 000 (Pakistan)

Similar variants

DNAAF1 p.Pro447Leu Uncertain significance ★★ ⚠ same residue
DNAAF1 p.Arg338fs Pathogenic/Likely pathogenic ★★ same condition
DNAAF1 p.Gly434fs Pathogenic/Likely pathogenic ★★ same condition
DNAAF1 c.1030+11_1030+22del Benign/Likely benign ★★ same condition
DNAAF1 c.864-17_864-14del Benign/Likely benign ★★ same condition
DNAAF1 c.(?_-181 Pathogenic ★ same condition
DNAAF1 p.Arg312fs Pathogenic ★ same condition
DNAAF1 p.Cys155fs Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/dnaaf1-p-pro447fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown