Is GP1BA p.Ser441fs (c.1322_1344del) pathogenic?

GP1BA p.Ser441fs (c.13221344del) is classified Benign/Likely benign in GP1BA (ClinVar, Multiple submitters, 6 submitters; last evaluated 2024-11-28). Common (popmax 25.3%, sas) — too common for a highly-penetrant pathogenic allele; Associated with nonarteritic anterior ischemic optic neuropathy, susceptibility to.

What condition is associated with GP1BA p.Ser441fs (c.1322_1344del)?

GP1BA p.Ser441fs (c.1322_1344del) is associated with nonarteritic anterior ischemic optic neuropathy, susceptibility to, Bernard-Soulier syndrome, type A2, autosomal dominant, platelet-type von Willebrand disease (ClinVar).

GP1BA p.Ser441fs

Q: How common is GP1BA p.Ser441fs (c.1322_1344del) in the general population?

GP1BA p.Ser441fs (c.1322_1344del) is common (popmax 25.3%, sas) — too common for a highly-penetrant pathogenic allele (gnomAD).

c.1322_1344del · rs770089708 · VCV435346

Benign/Likely benign Multiple submitters

Classification

Benign/Likely benign

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 6 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Common

common (popmax 25.3%, sas) — too common for a highly-penetrant pathogenic allele

Conditions

nonarteritic anterior ischemic optic neuropathy, susceptibility to

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (2 of 2) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -4.6	GERP -2.2
Overall
CADD	22.0	PHRED · no single calibrated threshold — expert panels disagree
Region caveats
Repeat context	tandem	CCAAGCCCGACCACCCCAGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACT simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 25.3% South Asian · 13,105/51,786 alleles

Filtering AF 24.9% ClinGen BA1/BS1 input FAF95, joint · FAF99 24.8%

Overall 16.2% 71,973/444,900 alleles · common

Ancestry group	Frequency	1 in
Amishnot grpmax-eligible	49.5%	2
South Asiangrpmax	25.3%	4
East Asian	24.9%	4
Admixed American	19.4%	5
Remaining individualsnot grpmax-eligible	17.2%	6
African / African-American	16.7%	6
Finnishnot grpmax-eligible	14.2%	7
European (non-Finnish)	13.9%	7
Middle Eastern	11.2%	9
Ashkenazi Jewishnot grpmax-eligible	9.26%	11

Amish shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: GP1BA
Protein: p.Ser441fs
Coding: c.1322_1344del
MANE Select: NM_000173
dbSNP: rs770089708
Type: Deletion
Location: chr17:4933926 (GRCh38)
Gene constraint: LOEUF 1.289 · pLI 0.10 (gnomAD)
Structure: AlphaFold pLDDT 64.65 · 22 PDB
Residue 441: the 'disordered' region

Full GP1BA gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

nonarteritic anterior ischemic optic neuropathy, susceptibility to — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Also linked: Bernard-Soulier syndrome, type A2, autosomal dominant platelet-type von Willebrand disease Bernard-Soulier syndrome

Similar variants

GP1BA p.Ala318fs Likely pathogenic ★★★ same condition
GP1BA p.Arg358_Trp359insTer Likely pathogenic ★★★ same condition
GP1BA p.Asn32fs Likely pathogenic ★★★ same condition
GP1BA p.Glu489fs Likely pathogenic ★★★ same condition
GP1BA p.Leu365fs Likely pathogenic ★★★ same condition
GP1BA p.Leu531fs Likely pathogenic ★★★ same condition
GP1BA p.Leu8fs Likely pathogenic ★★★ same condition
GP1BA p.Leu92fs Likely pathogenic ★★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/gp1ba-p-ser441fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown