Is PRX p.Pro518fs (c.1552_1558del) pathogenic?

PRX p.Pro518fs (c.15521558del) is classified Pathogenic in PRX (ClinVar, Single submitter, 1 submitter; last evaluated 2022-05-04). No gnomAD frequency available for this variant; Associated with Charcot-Marie-Tooth disease type 3.

What condition is associated with PRX p.Pro518fs (c.1552_1558del)?

PRX p.Pro518fs (c.1552_1558del) is associated with Charcot-Marie-Tooth disease type 3 (ClinVar).

How common is PRX p.Pro518fs (c.1552_1558del) in the general population?

PRX p.Pro518fs (c.1552_1558del) is no gnomAD frequency available for this variant (gnomAD).

How is Dejerine-Sottas syndrome inherited?

Typically Autosomal dominant, Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

PRX p.Pro518fs

c.1552_1558del · rs2079443119 · VCV1686102

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

Charcot-Marie-Tooth disease type 3

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (7 of 7) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 4	GERP 0.12, phastCons 0.14
Region caveats
Repeat context	tandem	GGGAGTTTCATCTCTGACACTTTCGGCAGCTGTACCTCTGGAAGCCGCACCTCCGGCACAGCCATCTCTGGCACCTTT simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: PRX
Protein: p.Pro518fs
Coding: c.1552_1558del
MANE Select: NM_181882
dbSNP: rs2079443119
Type: Deletion
Location: chr19:40396794 (GRCh38)
Gene constraint: LOEUF 1.321 · pLI <0.01 (gnomAD)
Structure: AlphaFold pLDDT 35.74 · 1 PDB
Residue 518: the '55 x 5 aa approximate tandem repeats of [lvmag]-[psreqc]-[edkl]-[livmap]-[aqkhrpe]; that may have a tripeptide spacer of [lv]-p-[ker]' region

Full PRX gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

Charcot-Marie-Tooth disease type 3 — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Dejerine-Sottas syndrome (Orphanet):

Inheritance: Autosomal dominant, Autosomal recessive, Not applicable
Onset: Infancy
Prevalence: <1 / 1 000 000 (Worldwide)

Similar variants

PRX p.Lys924fs Likely pathogenic ★ same condition
PRX p.Ala338fs Pathogenic same condition
PRX p.Leu83fs Conflicting classifications of pathogenicity same condition
PRX p.Arg1070Ter Pathogenic/Likely pathogenic ★★ same condition
PRX p.Arg364Ter Pathogenic ★★ same condition
PRX p.Arg392Ter Pathogenic/Likely pathogenic ★★ same condition
PRX p.Arg897Ter Pathogenic/Likely pathogenic ★★ same condition
PRX p.Ala1036Val Uncertain significance ★★ ⚠ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/prx-p-pro518fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown