ALMS1 p.Ala792fs
c.2370_2371del · rs1271517550 · VCV1072647
Computational evidence
| Protein change | ||
| Missense predictors do not apply to this variant type; conservation carries the signal. | ||
| Consequence | frameshift | predicted loss-of-function |
|---|---|---|
| NMD | predicted | premature termination codon in exon 8 of 23 |
| Splicing | ||
| SpliceAI | — | not assessed · substitutions only |
| Constraint at this position | ||
| Conservation | phyloP -8.1 | GERP -3.1 |
| Region caveats | ||
| Repeat context | tandem | CAGATAGTCATCTAACTGAAGAGGCTCTGAAAGTTTCAGCTGTTCCTGGACCAGCTGACCAGAAGACTGGCATACCAACTGTAACCTCTACTTCCTACTCACATAGAGAGAAGCCTAGTATTTTCTACCAACAGGCCTTGC simple repeat · ambiguous alignment · confidence, not pathogenicity |
Predicted loss-of-function is descriptive, not an applied PVS1 code.
Population frequency
| Ancestry group | Frequency | 1 in |
|---|---|---|
| Ashkenazi Jewishnot grpmax-eligible | 0.00338% | 29,604 |
| European (non-Finnish)grpmax | 8.47e-05% | 1,179,993 |
Ashkenazi Jewish shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.
Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.
Variant & gene context
- Gene
- ALMS1
- Protein
- p.Ala792fs
- Coding
- c.2370_2371del
- MANE Select
- NM_001378454
- dbSNP
- rs1271517550
- Type
- Deletion
- Location
- chr2:73448896 (GRCh38)
- Gene constraint
- LOEUF 0.825 · pLI <0.01 · ClinGen HI gene assoc. with recessive phenotype (gnomAD)
- Residue 792
- the '34 x 47 aa approximate tandem repeat' region
Disease context
Alstrom syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatmentsFor Alström syndrome (Orphanet):
- Inheritance
- Autosomal recessive
- Onset
- Adolescent, Adult, Childhood, Infancy, Neonatal
- Prevalence
- 1-9 / 1 000 000 (Europe)
Similar variants
- ALMS1 p.Ala792Pro Uncertain significance ★ ⚠ same residue
- ALMS1 c.1432+2_1432+15del Likely pathogenic ★★ same condition
- ALMS1 c.9782-1269_9859del Likely pathogenic ★★ same condition
- ALMS1 p.Ala1083fs Pathogenic ★★ same condition
- ALMS1 p.Ala1515fs Pathogenic/Likely pathogenic ★★ same condition
- ALMS1 p.Ala3307fs Pathogenic/Likely pathogenic ★★ same condition
- ALMS1 p.Ala50fs Pathogenic ★★ same condition
- ALMS1 p.Arg1417fs Pathogenic ★★ same condition
Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →
Cite Sugi Variant
Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/alms1-p-ala792fs (accessed [today's date]).
Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown