Is ALMS1 p.Arg1668fs (c.5002del) pathogenic?

ALMS1 p.Arg1668fs (c.5002del) is classified Pathogenic/Likely pathogenic in ALMS1 (ClinVar, Multiple submitters, 3 submitters; last evaluated 2025-12-03). Absent from gnomAD; Associated with Alstrom syndrome.

What condition is associated with ALMS1 p.Arg1668fs (c.5002del)?

ALMS1 p.Arg1668fs (c.5002del) is associated with Alstrom syndrome (ClinVar).

How common is ALMS1 p.Arg1668fs (c.5002del) in the general population?

ALMS1 p.Arg1668fs (c.5002del) is absent from gnomAD (gnomAD).

How is Alström syndrome inherited?

Typically Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

ALMS1 p.Arg1668fs

c.5002del · rs1572936092 · VCV817439

Pathogenic/Likely pathogenic Multiple submitters

Classification

Pathogenic/Likely pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 3 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

Alstrom syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	predicted	premature termination codon in exon 8 of 23
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -20	GERP -4.1
Region caveats
Repeat context	tandem	CAGATAGTCATCTAACTGAAGAGGCTCTGAAAGTTTCAGCTGTTCCTGGACCAGCTGACCAGAAGACTGGCATACCAACTGTAACCTCTACTTCCTACTCACATAGAGAGAAGCCTAGTATTTTCTACCAACAGGCCTTGC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: ALMS1
Protein: p.Arg1668fs
Coding: c.5002del
MANE Select: NM_001378454
dbSNP: rs1572936092
Type: Deletion
Location: chr2:73451529 (GRCh38)
Gene constraint: LOEUF 0.825 · pLI <0.01 · ClinGen HI gene assoc. with recessive phenotype (gnomAD)
Residue 1668: the '34 x 47 aa approximate tandem repeat' region

Full ALMS1 gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

Alstrom syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Alström syndrome (Orphanet):

Inheritance: Autosomal recessive
Onset: Adolescent, Adult, Childhood, Infancy, Neonatal
Prevalence: 1-9 / 1 000 000 (Europe)

Similar variants

ALMS1 p.Arg1668= Likely benign ★★ same residue
ALMS1 p.Arg1668Gly Uncertain significance ★ ⚠ same residue
ALMS1 p.Arg1668Ser Uncertain significance ★ ⚠ same residue
ALMS1 c.1432+2_1432+15del Likely pathogenic ★★ same condition
ALMS1 c.9782-1269_9859del Likely pathogenic ★★ same condition
ALMS1 p.Ala1083fs Pathogenic ★★ same condition
ALMS1 p.Ala1515fs Pathogenic/Likely pathogenic ★★ same condition
ALMS1 p.Ala3307fs Pathogenic/Likely pathogenic ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/alms1-p-arg1668fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown