Is CDKN2A p.Ser7fs (c.18del) pathogenic?

CDKN2A p.Ser7fs (c.18del) is classified Pathogenic in CDKN2A (ClinVar, Single submitter, 1 submitter; last evaluated 2025-08-14). Associated with melanoma-pancreatic cancer syndrome.

What condition is associated with CDKN2A p.Ser7fs (c.18del)?

CDKN2A p.Ser7fs (c.18del) is associated with melanoma-pancreatic cancer syndrome (ClinVar).

CDKN2A p.Ser7fs

Q: How is Familial atypical multiple mole melanoma syndrome inherited?

Typically Autosomal dominant (Orphanet). A genetic counselor can assess individual risk for a family.

c.18del · VCV4294202

Pathogenic Single submitter

Classification

Pathogenic

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Rare

Conditions

melanoma-pancreatic cancer syndrome

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function in a haploinsufficient gene (ClinGen)
NMD	predicted	premature termination codon in exon 1 of 3
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP -0.34	GERP -3.6
Region caveats
Repeat context	tandem	GGCTCCATGCTGCTCCCCGCCGCC simple repeat · ambiguous alignment · confidence, not pathogenicity

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Variant & gene context

Gene: CDKN2A
Protein: p.Ser7fs
Coding: c.18del
MANE Select: NM_000077
Type: Deletion
Location: chr9:21974810 (GRCh38)
Gene constraint: LOEUF 0.791 · pLI 0.62 · ClinGen HI 3/3 (gnomAD)
Structure: AlphaFold pLDDT 77.02 · 5 PDB
Residue 7: a modified residue (phosphoserine); the 'interaction with cdk5rap3 and mdm2' region

Full CDKN2A gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

melanoma-pancreatic cancer syndrome — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Familial atypical multiple mole melanoma syndrome (Orphanet):

Inheritance: Autosomal dominant
Onset: All ages

Similar variants

CDKN2A p.Ser7= Benign ★ same residue
CDKN2A p.Val7= Benign ★ same residue
CDKN2A p.Ala36fs Pathogenic ★★ same condition
CDKN2A p.Ala76fs Pathogenic/Likely pathogenic ★★ same condition
CDKN2A p.Pro81fs Pathogenic ★★ same condition
CDKN2A p.Ser43_Tyr44insTer Pathogenic ★★ same condition
CDKN2A c.194-3646_194-3624del Uncertain significance ★★ same condition
CDKN2A c.193+10del Likely benign ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/cdkn2a-p-ser7fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown