Is EMD p.Leu217fs (c.650_654del) pathogenic?

EMD p.Leu217fs (c.650654del) is classified Pathogenic in EMD (ClinVar, Multiple submitters, 2 submitters; last evaluated 2026-03-27). Absent from gnomAD; Associated with Cardiovascular phenotype.

What condition is associated with EMD p.Leu217fs (c.650_654del)?

EMD p.Leu217fs (c.650_654del) is associated with Cardiovascular phenotype, X-linked Emery-Dreifuss muscular dystrophy (ClinVar).

How common is EMD p.Leu217fs (c.650_654del) in the general population?

EMD p.Leu217fs (c.650_654del) is absent from gnomAD (gnomAD).

EMD p.Leu217fs

c.650_654del · rs730880352 · VCV1075797

Pathogenic Multiple submitters

Classification

Pathogenic

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 2 submitters

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

Cardiovascular phenotype

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (6 of 6) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 1.5	GERP -0.6, phastCons 0.22

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: EMD
Protein: p.Leu217fs
Coding: c.650_654del
MANE Select: NM_000117
dbSNP: rs730880352
Type: Microsatellite
Location: chrX:154381073 (GRCh38)
Structure: AlphaFold pLDDT 61.26 · 6 PDB
Residue 217: the 'interaction with f-actin' region

Full EMD gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

Cardiovascular phenotype — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Also linked: X-linked Emery-Dreifuss muscular dystrophy

Similar variants

EMD p.Leu217= Likely benign ★ same residue
EMD p.Gln119_Ser120insTer Pathogenic/Likely pathogenic ★★ same condition
EMD p.Ser143del Uncertain significance ★★ same condition
EMD p.Ser199del Uncertain significance ★★ same condition
EMD c.400-13CT[2] Benign/Likely benign ★★ same condition
EMD c.-161CAACGATTCGGCTGTGACGCGA[1] Likely benign ★★ same condition
EMD p.Lys79fs Pathogenic ★ same condition
EMD p.Leu231del Uncertain significance ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/emd-p-leu217fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown