Is EMD p.Ser143del (c.421TCT[2]) pathogenic?

EMD p.Ser143del (c.421TCT[2]) is classified Uncertain significance in EMD (ClinVar, Multiple submitters, 2 submitters; last evaluated 2022-02-03). Very rare (popmax 0.00176%, sas); Associated with Cardiovascular phenotype.

What condition is associated with EMD p.Ser143del (c.421TCT[2])?

EMD p.Ser143del (c.421TCT[2]) is associated with Cardiovascular phenotype, X-linked Emery-Dreifuss muscular dystrophy (ClinVar).

How common is EMD p.Ser143del (c.421TCT[2]) in the general population?

EMD p.Ser143del (c.421TCT[2]) is very rare (popmax 0.00176%, sas) (gnomAD).

EMD p.Ser143del

c.421TCT[2] · rs1557182551 · VCV652189

Uncertain significance Multiple submitters

Classification

Uncertain significance

ClinVar

Review

Multiple submitters ★★☆☆

ClinVar · 2 submitters

gnomAD v4.1

Rare

very rare (popmax 0.00176%, sas)

Conditions

Cardiovascular phenotype

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.13	GERP -2.1, phastCons 0.97
Overall
CADD	8.281	PHRED · no single calibrated threshold — expert panels disagree

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.00176% South Asian · 1/56,887 alleles

Filtering AF 0.000325% ClinGen BA1/BS1 input FAF95, joint · FAF99 0.000209%

Overall 0.00132% 16/1,210,589 alleles · very rare

Ancestry group	Frequency	1 in
Finnishnot grpmax-eligible	0.015%	6,661
Remaining individualsnot grpmax-eligible	0.0021%	47,607
South Asiangrpmax	0.00176%	56,887
European (non-Finnish)	0.000782%	127,898

Finnish shows a higher raw frequency than the grpmax group above it. gnomAD excludes bottlenecked groups — Finnish, Ashkenazi Jewish, Amish and “Remaining individuals” — from grpmax, because founder effects make their frequencies unrepresentative for filtering. The table is sorted by frequency, so an excluded group can sit above the grpmax row.

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: EMD
Protein: p.Ser143del
Coding: c.421TCT[2]
MANE Select: NM_000117
dbSNP: rs1557182551
Type: Microsatellite
Location: chrX:154380774 (GRCh38)
Structure: AlphaFold pLDDT 61.26 · 6 PDB
Residue 143: a modified residue (phosphoserine); the 'interaction with f-actin' region

Full EMD gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

Cardiovascular phenotype — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

Also linked: X-linked Emery-Dreifuss muscular dystrophy

Similar variants

EMD p.Ser143Phe Conflicting classifications of pathogenicity ★ ⚠ same residue
EMD p.Gln119_Ser120insTer Pathogenic/Likely pathogenic ★★ same condition
EMD p.Leu217fs Pathogenic ★★ same condition
EMD p.Ser199del Uncertain significance ★★ same condition
EMD c.400-13CT[2] Benign/Likely benign ★★ same condition
EMD c.-161CAACGATTCGGCTGTGACGCGA[1] Likely benign ★★ same condition
EMD p.Lys79fs Pathogenic ★ same condition
EMD p.Ser143_Glu144delinsTer Pathogenic ★ same residue

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/emd-p-ser143del (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown