Is EMD p.Phe240fs (c.717_718del) pathogenic?

EMD p.Phe240fs (c.717718del) is classified Uncertain significance in EMD (ClinVar, Single submitter, 1 submitter; last evaluated 2024-04-30). Absent from gnomAD; Associated with X-linked Emery-Dreifuss muscular dystrophy.

What condition is associated with EMD p.Phe240fs (c.717_718del)?

EMD p.Phe240fs (c.717_718del) is associated with X-linked Emery-Dreifuss muscular dystrophy (ClinVar).

How common is EMD p.Phe240fs (c.717_718del) in the general population?

EMD p.Phe240fs (c.717_718del) is absent from gnomAD (gnomAD).

How is Emery-Dreifuss muscular dystrophy inherited?

Typically Autosomal dominant, Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

EMD p.Phe240fs

c.717_718del · rs1603366041 · VCV661271

Uncertain significance Single submitter

Classification

Uncertain significance

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

Consequence

frameshift

predicted LoF

gnomAD v4.1

Not reported

no gnomAD frequency available for this variant

Conditions

X-linked Emery-Dreifuss muscular dystrophy

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Consequence	frameshift	predicted loss-of-function
NMD	escapes	premature termination codon in the last exon (6 of 6) — the truncated protein is likely expressed. PVS1 input, not an applied code
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 0.25	GERP -1.6, phastCons 0.99

Predicted loss-of-function is descriptive, not an applied PVS1 code.

Population frequency

dbSNP / gnomAD

No gnomAD frequency available for this variant. This is missing data, not an absence: the variant may or may not be present in gnomAD. Rarity (ACMG PM2) and BA1/BS1 cannot be assessed for it.

Variant & gene context

Gene: EMD
Protein: p.Phe240fs
Coding: c.717_718del
MANE Select: NM_000117
dbSNP: rs1603366041
Type: Microsatellite
Location: chrX:154381147 (GRCh38)
Structure: AlphaFold pLDDT 61.26 · 6 PDB

Full EMD gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

X-linked Emery-Dreifuss muscular dystrophy — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Emery-Dreifuss muscular dystrophy (Orphanet):

Inheritance: Autosomal dominant, Autosomal recessive, X-linked recessive
Onset: Childhood
Prevalence: 1-9 / 1 000 000 (Europe)

Similar variants

EMD p.Phe240= Likely benign ★★ same residue
EMD p.Phe240Leu Conflicting classifications of pathogenicity ★ ⚠ same residue
EMD p.Gln119_Ser120insTer Pathogenic/Likely pathogenic ★★ same condition
EMD p.Leu217fs Pathogenic ★★ same condition
EMD p.Ser143del Uncertain significance ★★ same condition
EMD p.Ser199del Uncertain significance ★★ same condition
EMD c.400-13CT[2] Benign/Likely benign ★★ same condition
EMD c.-161CAACGATTCGGCTGTGACGCGA[1] Likely benign ★★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/emd-p-phe240fs (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown