Is EMD p.Phe241del (c.718TTC[1]) pathogenic?

EMD p.Phe241del (c.718TTC[1]) is classified Uncertain significance in EMD (ClinVar, Single submitter, 1 submitter; last evaluated 2024-08-15). Very rare (popmax 0.000112%, nfe); Associated with X-linked Emery-Dreifuss muscular dystrophy.

What condition is associated with EMD p.Phe241del (c.718TTC[1])?

EMD p.Phe241del (c.718TTC[1]) is associated with X-linked Emery-Dreifuss muscular dystrophy (ClinVar).

How common is EMD p.Phe241del (c.718TTC[1]) in the general population?

EMD p.Phe241del (c.718TTC[1]) is very rare (popmax 0.000112%, nfe) (gnomAD).

How is Emery-Dreifuss muscular dystrophy inherited?

Typically Autosomal dominant, Autosomal recessive (Orphanet). A genetic counselor can assess individual risk for a family.

EMD p.Phe241del

c.718TTC[1] · rs2148129019 · VCV1499662

Uncertain significance Single submitter

Classification

Uncertain significance

ClinVar

Review

Single submitter ★☆☆☆

ClinVar · 1 submitter

gnomAD v4.1

Rare

very rare (popmax 0.000112%, nfe)

Conditions

X-linked Emery-Dreifuss muscular dystrophy

Computational evidence

Protein change
Missense predictors do not apply to this variant type; conservation carries the signal.
Splicing
SpliceAI	—	not assessed · substitutions only
Constraint at this position
Conservation	phyloP 2.9	GERP -0.97, phastCons 1

Population frequency

gnomAD v4.1 · exomes + genomes

Grpmax group 0.000112% European (non-Finnish) · 1/895,498 alleles

Overall 9.11e-05% 1/1,098,029 alleles · very rare

Rarity supports pathogenicity (ACMG PM2); frequency above a disease-specific BA1/BS1 threshold argues against it. A variant frequent in one ancestry group can be near-absent in others, so a single global figure can mislead.

Variant & gene context

Gene: EMD
Protein: p.Phe241del
Coding: c.718TTC[1]
MANE Select: NM_000117
dbSNP: rs2148129019
Type: Microsatellite
Location: chrX:154381148 (GRCh38)
Structure: AlphaFold pLDDT 61.26 · 6 PDB

Full EMD gene report on Sugi Atlas → Gene function, pathways, protein structure, interactions & more

Disease context

X-linked Emery-Dreifuss muscular dystrophy — disease report on Sugi Atlas → Associated genes, phenotypes, clinical trials & treatments

For Emery-Dreifuss muscular dystrophy (Orphanet):

Inheritance: Autosomal dominant, Autosomal recessive, X-linked recessive
Onset: Childhood
Prevalence: 1-9 / 1 000 000 (Europe)

Similar variants

EMD p.Phe241= Likely benign ★ same residue
EMD p.Gln119_Ser120insTer Pathogenic/Likely pathogenic ★★ same condition
EMD p.Leu217fs Pathogenic ★★ same condition
EMD p.Ser143del Uncertain significance ★★ same condition
EMD p.Ser199del Uncertain significance ★★ same condition
EMD c.400-13CT[2] Benign/Likely benign ★★ same condition
EMD c.-161CAACGATTCGGCTGTGACGCGA[1] Likely benign ★★ same condition
EMD p.Lys79fs Pathogenic ★ same condition

Built on 18 open, versioned datasets — ClinVar, gnomAD, AlphaMissense, REVEL, ClinGen & more — plus Sugi Variant's own cross-source analysis. Source data 2026-01–2026-10, ClinVar 2026-10. Full sources & versions →

Cite Sugi Variant

Gür T. Sugi Variant: A Deterministic Per-Variant Germline Reference from a Knowledge Graph for Humans and AI Agents. 2026. doi:10.5281/zenodo.21509445. This variant: https://sugi.bio/variant/emd-p-phe241del (accessed [today's date]).

Preprint & method: sugi.bio/variant/method Machine-readable: this page as Markdown